Top » Catalog » SNPs » A10940

$18.00

A10940
[A10940]

A10940
hg38 Position: ChrY:11876714..11876714
Ancestral: G
Derived: T
Reference: Wanda Taylor (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below U106 > L48 > Z12 > A5616
Forward Primer: A10940_F CTACACAATCATTCATTGGACTGC
Reverse Primer: A10940_R GTTTACAACATGCTGTTATGGAATC
Reviews

Customers who bought this product also purchased
A10942
A10942
A10938
A10938
A10937
A10937
A10947
A10947
A5616
A5616
A10944
A10944
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10503
$18.00
Haplogroup Info
Other products
Currencies