Top » Catalog » SNPs » A10942

$18.00

A10942
[A10942]

A10942
HG19 Position: ChrY:14672081..14672081
Ancestral: A
Derived: C
Reference: Wanda Taylor (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below U106 > L48 > Z12 > A5616
Forward Primer: A10942_F CCCCTTATTTCTGAGGAGAAAGAC
Reverse Primer: A10942_R TCTTTATCTCCTGATCTCGTAATCCT
Reviews

Customers who bought this product also purchased
A5616
A5616
A10944
A10944
R1b-U106 Tucker Panel
R1b-U106 Tucker Panel
A10943
A10943
A10940
A10940
A10938
A10938
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies