Top » Catalog » SNPs » A10942

$17.50

A10942
[A10942]

A10942
HG19 Position: ChrY:16783961..16783961
Ancestral: A
Derived: C
Reference: Wanda Taylor (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below U106 > L48 > Z12 > A5616
Forward Primer: A10942_F CCCCTTATTTCTGAGGAGAAAGAC
Reverse Primer: A10942_R TCTTTATCTCCTGATCTCGTAATCCT
Reviews

Customers who bought this product also purchased
A10940
A10940
A10938
A10938
A10937
A10937
A10947
A10947
A5616
A5616
A10944
A10944
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies