Top » Catalog » SNPs » A10944

$18.00

A10944
[A10944]

A10944
HG19 Position: ChrY:17249646..17249646
Ancestral: T
Derived: G
Reference: Wanda Taylor (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below U106 > L48 > Z12 > A5616
Forward Primer: A10944_F AACCCATCATAAGTTGAACATGC
Reverse Primer: A10944_R CATTCACATGCAGACACAGATG
Reviews

Customers who bought this product also purchased
A10938
A10938
A10937
A10937
A10947
A10947
A5616
A5616
A10943
A10943
R1b-U106 Tucker Panel
R1b-U106 Tucker Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10870
1 x A1155
1 x A11616
1 x A11227
1 x A10756
$90.00
Haplogroup Info
Other products
Currencies