Top » Catalog » SNPs » A10947

$18.00

A10947
[A10947]

A10947
HG19 Position: ChrY:21733894..21733894
Ancestral: G
Derived: T
Reference: Wanda Taylor (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below U106 > L48 > Z12 > A5616
Forward Primer: A10947_F TGTGGAGATCTGGAGAGTAAAAGTG
Reverse Primer: A10947_R AGGGTTCTTGCTAGATTTAGTTTGTAC
Reviews

Customers who bought this product also purchased
A10938
A10938
A10937
A10937
A10944
A10944
A5616
A5616
A10943
A10943
R1b-U106 Tucker Panel
R1b-U106 Tucker Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10869
1 x A10748
1 x A10875
1 x A10586
$72.00
Haplogroup Info
Other products
Currencies