Top » Catalog » SNPs » A11101

$18.00

A11101
[A11101]

A11101
HG19 Position: ChrY:17086799..17086799
Ancestral: ins
Derived: del
Reference: Richard McDevitt (2016)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: A11101_F CACAATGTGTCAGGATTAAATTGG
Reverse Primer: A11101_R TGTGATCATGCGAGTAAAGAGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies