Top » Catalog » SNPs » A11101

$18.00

A11101
[A11101]

A11101
HG19 Position: ChrY:14974919..14974919
Ancestral: ins
Derived: del
Reference: Richard McDevitt (2016)
ISOGG Haplogroup: R1b
Comments: M222 > DF105 > DF85 > S673 > DF97 > A11230
Forward Primer: A11101_F CACAATGTGTCAGGATTAAATTGG
Reverse Primer: A11101_R TGTGATCATGCGAGTAAAGAGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10130
1 x A10007
1 x A11103
$54.00
Haplogroup Info
Other products
Currencies