Top » Catalog » SNPs » ZS8815

$18.00

ZS8815
[ZS8815]

ZS8815
hg38 Position: ChrY:8855043..8855043
Ancestral: T
Derived: C
Reference: Victar Mas (2015)
ISOGG Haplogroup: J1
Comments: downstream FGC2
Forward Primer: ZS8815_F CACGTTACGAATTAAGTTGAATATCTTTTC
Reverse Primer: ZS8815_R AATTGACCATCTGCCAGCTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies