Top » Catalog » SNPs » FGC1722

$19.00

FGC1722
[FGC1722]

FGC1722
hg38 Position: ChrY:16629835..16629835
Ancestral: T
Derived: C
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1-FGC11
Comments: Downstream of J1-L858 and FGC11
Forward Primer: FGC1722_F CACACATAACCATGCCCAAC
Reverse Primer: FGC1722_R GGAACCTCTCATATTCCACACC
Reviews

Customers who bought this product also purchased
FT62152
FT62152
FGC1720
FGC1720
Y329934
Y329934
YMA27
YMA27
BY8
BY8
FGC1731
FGC1731
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies