Top » Catalog » SNPs » FGC4422

$18.00

FGC4422
[FGC4422]

FGC4422
hg38 Position: ChrY:14458796..14458796
Ancestral: C
Derived: G
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1-FGC12
Comments: Downstream of J1-FGC12
Forward Primer: FGC4422_F TGGCAGCATTTCATACTTGC
Reverse Primer: FGC4422_R TGCAAAATTCTGCTTTCCTG
Reviews

Customers who bought this product also purchased
ZS10743
ZS10743
ZS10622
ZS10622
FGC75265
FGC75265
ZS4946
ZS4946
ZS4740
ZS4740
FT207436
FT207436
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies