Top » Catalog » SNPs » FGC50130

$19.00

FGC50130
[FGC50130]

FGC50130
hg38 Position: ChrY:15333909..15333909
Ancestral: C
Derived: G
Reference: Full Genomes Corp (2016)
ISOGG Haplogroup: unknown
Comments: .
Forward Primer: FGC50130_F GAAACAGGGATTGTGGCATC
Reverse Primer: FGC50130_R TGGAGGGCTGAATTCTTCTG
Reviews

Customers who bought this product also purchased
FGC50124
FGC50124
FGC50127
FGC50127
A12500
A12500
A12499
A12499
FGC50135
FGC50135
FGC50129
FGC50129
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies