Top » Catalog » SNPs » A11431

$18.00

A11431
[A11431]

A11431
HG19 Position: ChrY:19523292..19523292
Ancestral: C
Derived: T
Reference: Raymond Wing (2016)
ISOGG Haplogroup: R1b
Comments: Downstream L200
Forward Primer: A11431_F TGCCTGGTTTGTTCTGTGAC
Reverse Primer: A11431_R GGCAAGGGAGAAGTCAGTTTAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A11528
1 x A10510
$36.00
Haplogroup Info
Other products
Currencies