Top » Catalog » SNPs » A12594

$18.00

A12594
[A12594]

A12594
hg38 Position: ChrY:15432526..15432526
Ancestral: G
Derived: A
Reference: Ed Aber Leek (2016)
ISOGG Haplogroup: R1b
Comments: Downstream A761
Forward Primer: A12594_F GTCCTCCTCCAAGTCAGGTG
Reverse Primer: A12594_R TGTTGGGAGCAAACTGAGTG
Reviews

Customers who bought this product also purchased
A88
A88
A761
A761
Z16254
Z16254
A11843
A11843
A195
A195
A12592
A12592
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies