Top » Catalog » SNPs » rs12487205

$19.00

rs12487205
[rs12487205]

rs12487205
hg38 Position: Chr3:151443324..151443324
Ancestral: A
Derived: G
Reference: dbSNP
ISOGG Haplogroup: none
Comments: .
Forward Primer: rs12487205_F CCACATTATTTGGGGTTTGG
Reverse Primer: rs12487205_R TCCAGAGGGTGGAAATTCAG
Reviews

Customers who bought this product also purchased
Z343
Z343
YSEQ-Alpha
YSEQ-Alpha
HVR1
HVR1
HVR2
HVR2
rs113558962
rs113558962
rs115117205
rs115117205
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies