Top » Catalog » SNPs » S1393

$18.00

S1393
[S1393]

S1393
hg38 Position: ChrY:11906288..11906288
Ancestral: A
Derived: G
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b
Comments: Downstream Z21380
Forward Primer: S1393_F ATAGATACCCTAAAGGCTAGATGGATG
Reverse Primer: S1393_R GAATGGATGAAAGATGGATACATAAG
Reviews

Customers who bought this product also purchased
L719
L719
Z21280
Z21280
DF19
DF19
Z21380
Z21380
BY19349
BY19349
R1b-DF19 Panel
R1b-DF19 Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies