Top » Catalog » SNPs » A11341

$18.00

A11341
[A11341]

A11341
HG19 Position: ChrY:9069304..9069304
Ancestral: A
Derived: C
Reference: William Hartley (2016)
ISOGG Haplogroup: I1
Comments: Downstream I1-Z140 A196+ Y6900+ Y6908+ Y6910+
Forward Primer: A11341_F ATTTTTTGCATTTTTAGTAGACAGGG
Reverse Primer: A11341_R AAAGCATAAGGCAAACCCAC
Reviews

Customers who bought this product also purchased
A11556
A11556
A11555
A11555
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies