Top » Catalog » SNPs » A11555

$18.00

A11555
[A11555]

A11555
hg38 Position: ChrY:15398780..15398780
Ancestral: C
Derived: A
Reference: William Hartley (2016)
ISOGG Haplogroup: I1
Comments: Downstream I1-Z140 [07] A196+
Forward Primer: A11555_F AGCTGCTTCTATGCTTCCTG
Reverse Primer: A11555_R TTACATCAGGCATGCTTTGC
Reviews

Customers who bought this product also purchased
A11341
A11341
A11556
A11556
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies