Top » Catalog » SNPs » A11556

$18.00

A11556
[A11556]

A11556
HG19 Position: ChrY:16289441..16289441
Ancestral: C
Derived: T
Reference: William Hartley (2016)
ISOGG Haplogroup: I1
Comments: Downstream I1-Z140 [07] A196+
Forward Primer: A11556_F GGGGAAAGAATGTAAACCTAATAAGC
Reverse Primer: A11556_R GTCTCACACTCCTGGCCTCAAGTGATCC
Reviews

Customers who bought this product also purchased
A11555
A11555
A11341
A11341
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies