Top » Catalog » SNPs » ZS8254

$18.00

ZS8254
[ZS8254]

ZS8254
hg38 Position: ChrY:7759603..7759603
Ancestral: C
Derived: T
Reference: Victar Mas (2015)
ISOGG Haplogroup: J1
Comments: Downstream ZS7093
Forward Primer: ZS8254_F GGCCAACAGCTTTCAGATTG
Reverse Primer: ZS8254_R AGATGGGAGGATTGCTTGAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies