Top » Catalog » SNPs » DF104

$18.00

DF104
[DF104]

DF104
hg38 Position: ChrY:2937793..2937793
Ancestral: C
Derived: T
Reference: Andy Gierson (2013)
ISOGG Haplogroup: R1b1a1a2a1a2c1a1a1a1a1
Comments: .
Forward Primer: DF104_F GACTGCTGCTTCGTTTTTGC
Reverse Primer: DF104_R CAGCAATCTCTAGTTCCCTTCAG
Reviews

Customers who bought this product also purchased
FGC23742
FGC23742
A10642
A10642
FT252196
FT252196
FT410057
FT410057
A2501
A2501
FGC32795
FGC32795
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies