Top » Catalog » SNPs » A11401

$17.50

A11401
[A11401]

A11401
HG19 Position: ChrY:3716047..3716047
Ancestral: T
Derived: C
Reference: William Hartley (2016)
ISOGG Haplogroup: I1
Comments: I1-Z140 Z141+ [13] Branch
Forward Primer: A11401_F TGGGACTTTCATTCATTCTTG
Reverse Primer: A11401_R CTACAGGCACATGGCACCAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies