Top » Catalog » SNPs » A11402

$18.00

A11402
[A11402]

A11402
HG19 Position: ChrY:19061177..19061177
Ancestral: T
Derived: A
Reference: William Hartley (2016)
ISOGG Haplogroup: I1
Comments: I1-Z140 Z141+ [13] Branch
Forward Primer: A11402_F CCACAAAGTCACTGCAATCG
Reverse Primer: A11402_R GGACTACAGGCATGCACCAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A11619
1 x A10848
1 x A1146
1 x A1068
1 x A10289
$90.00
Haplogroup Info
Other products
Currencies