Top » Catalog » SNPs » A11403

$18.00

A11403
[A11403]

A11403
hg38 Position: ChrY:21295388..21295388
Ancestral: A
Derived: G
Reference: William Hartley (2016)
ISOGG Haplogroup: I1
Comments: I1-Z140 Z141+ [13] Branch
Forward Primer: A11403_F CCCATTCTCAGGCAGCAG
Reverse Primer: A11403_R CCCAGAACAGAGGAAAGCAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies