Top » Catalog » SNPs » A13650

$19.00

A13650
[A13650]

A13650
hg38 Position: ChrY:19649511..19649511
Ancestral: A
Derived: T
Reference: Ahmad Alroqi (2016)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: A13650_F CCTTTCCTATGGGAAGACTGG
Reverse Primer: A13650_R TTCCCAACTGAGGGAGTTTC
Reviews

Customers who bought this product also purchased
A13647
A13647
M4610
M4610
A13651
A13651
A13649
A13649
A13648
A13648
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies