Top » Catalog » SNPs » Y97130

$19.00

Y97130
[Y97130]

Y97130
hg38 Position: ChrY:14621562..14621562
Ancestral: C
Derived: T
Reference: YFull (2017)
ISOGG Haplogroup: R1b and E
Comments: Below E-FTC2914 and below R1b-Y1282
Forward Primer: Y97130_F AATATCCACATCACAATGACAGGA
Reverse Primer: Y97130_R CATATTGCCAAAGCTGCAGG
Reviews

Customers who bought this product also purchased
BY133702
BY133702
BY64165
BY64165
BY132146
BY132146
BY115386
BY115386
BY112741
BY112741
BY148765
BY148765
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies