Top » Catalog » SNPs » A10672

$17.50

A10672
[A10672]

A10672
HG19 Position: ChrY:19564365..19564365
Ancestral: T
Derived: G
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a1a2a1a1c1a1
Comments: Below U106 > DF98 > FGC15238
Forward Primer: A10672_F TTTTTCCCTTATATTGGTCTGG
Reverse Primer: A10672_R ACCTCTGCTGATCTGCCAAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies