Top » Catalog » SNPs » A10672

$18.00

A10672
[A10672]

A10672
hg38 Position: ChrY:17452485..17452485
Ancestral: T
Derived: G
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a1a2a1a1c1a1
Comments: Below U106 > DF98 > FGC15238
Forward Primer: A10672_F TTTTTCCCTTATATTGGTCTGG
Reverse Primer: A10672_R ACCTCTGCTGATCTGCCAAC
Reviews

Customers who bought this product also purchased
S11215
S11215
S1911
S1911
FGC15239
FGC15239
S18823
S18823
FGC15238
FGC15238
DF98
DF98
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies