Top » Catalog » SNPs » A10672

$18.00

A10672
[A10672]

A10672
hg38 Position: ChrY:17452485..17452485
Ancestral: T
Derived: G
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a1a2a1a1c1a1
Comments: Below U106 > DF98 > FGC15238
Forward Primer: A10672_F TTTTTCCCTTATATTGGTCTGG
Reverse Primer: A10672_R ACCTCTGCTGATCTGCCAAC
Reviews

Customers who bought this product also purchased
S18823
S18823
FGC15238
FGC15238
DF98
DF98
S11739
S11739
R1b-U106 Superclade Panel
R1b-U106 Superclade Panel
M6509
M6509
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies