Top » Catalog » SNPs » A10926

$17.50

A10926
[A10926]

A10926
HG19 Position: ChrY:21386284..21386284
Ancestral: G
Derived: A
Reference: Nigel McCarthy (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below L21 > L362 > ZS4606 > ZS4598
Forward Primer: A10926_F GCAGGAGAAGGGTGAAACAC
Reverse Primer: A10926_R TTGCAGGGACATGGATCAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies