Top » Catalog » SNPs » A10391

$18.00

A10391
[A10391]

A10391
HG19 Position: ChrY:13368109..13368109
Ancestral: A
Derived: C
Reference: William Hartley (2016)
ISOGG Haplogroup: I1
Comments: Downstream I-Z140 F2642+ FGC2491+
Forward Primer: A10391_F ATTACTGGGGAGGGGACTTG
Reverse Primer: A10391_R GGAGGCTGAGGCAGGAGAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A11511
1 x A11641
1 x A10874
1 x A10135
1 x A10511
$90.00
Haplogroup Info
Other products
Currencies