Top » Catalog » SNPs » A14486

$18.00

A14486
[A14486]

A14486
hg38 Position: ChrY:14630874..14630874
Ancestral: C
Derived: G
Reference: Bruce Cockburn (2017)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: A14486_F GGCACTTGGAGCTTTCTGTC
Reverse Primer: A14486_R TCACACCACTGTACCCCAAC
Reviews

Customers who bought this product also purchased
A14483
A14483
S5739
S5739
R1b-U106 Carnegie Panel
R1b-U106 Carnegie Panel
A14487
A14487
A14485
A14485
A14484
A14484
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies