Top » Catalog » SNPs » A10766

$18.00

A10766
[A10766]

A10766
HG19 Position: ChrY:2883506..2883506
Ancestral: C
Derived: T
Reference: Mendez et al. (2016)
ISOGG Haplogroup: A000-neanderthal
Comments: Neanderthal specific. intergenic Coverage 1
Forward Primer: A10766_F GCCAGAAAGTTGGCCAAAG
Reverse Primer: A10766_R GTCTCCATTTTGTGAACACACG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10964
1 x A10753
1 x A10749
$54.00
Haplogroup Info
Other products
Currencies