Top » Catalog » SNPs » A10766

$17.50

A10766
[A10766]

A10766
HG19 Position: ChrY:2751547..2751547
Ancestral: C
Derived: T
Reference: Mendez et al. (2016)
ISOGG Haplogroup: A000-neanderthal
Comments: Neanderthal specific. intergenic Coverage 1
Forward Primer: A10766_F GCCAGAAAGTTGGCCAAAG
Reverse Primer: A10766_R GTCTCCATTTTGTGAACACACG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies