Top » Catalog » SNPs » A10097

$17.50

A10097
[A10097]

A10097
HG19 Position: ChrY:17841608..17841608
Ancestral: A
Derived: G
Reference: William Hartley (2016)
ISOGG Haplogroup: I1a
Comments: Below DF29 > A5635
Forward Primer: A10097_F TTTGTGGCCATTCAGTTCTTC
Reverse Primer: A10097_R TGCTGCCTTTCTAAACAAACC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies