Top » Catalog » SNPs » Y28536

$18.00

Y28536
[Y28536]

Y28536
hg38 Position: ChrY:20671530..20671530
Ancestral: A
Derived: G
Reference: YFull (2016)
ISOGG Haplogroup: N1c (not listed)
Comments: Below CTS10760
Forward Primer: Y28536_F AGGAGATACAGGCAGGAGACC
Reverse Primer: Y28536_R AACTAGCTGGGCATGTTGATG
Reviews

Customers who bought this product also purchased
L1025
L1025
BY158
BY158
M2783
M2783
L551
L551
Y5004
Y5004
A17625
A17625
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies