Top » Catalog » SNPs » A10216

$18.00

A10216
[A10216]

A10216
HG19 Position: ChrY:17283266..17283266
Ancestral: T
Derived: C
Reference: William Hartley (2016)
ISOGG Haplogroup: I1
Comments: Downstream I-Z140 F2642+ FGC2491+
Forward Primer: A10216_F GCTCTGGGGATAGTTTGTGG
Reverse Primer: A10216_R TCAGAATGATCCCTGGGTTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A11162
1 x A11549
1 x A10963
1 x A11007
1 x A11697
1 x A10198
1 x A11396
1 x A1034
$144.00
Haplogroup Info
Other products
Currencies