Top » Catalog » SNPs » A653

$19.00

A653
[A653]

A653
hg38 Position: ChrY:12596294..12596294
Ancestral: A
Derived: T
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A653_F ATGGAAAATGGGTTGGTTTG
Reverse Primer: A653_R GTACACGTGCCACTAGACTTCTTG
Reviews

Customers who bought this product also purchased
A656
A656
A655
A655
A654
A654
A649
A649
A658
A658
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies