Top » Catalog » SNPs » FGC19639

$19.00

FGC19639
[FGC19639]

FGC19639
hg38 Position: ChrY:17050258..17050258
Ancestral: T
Derived: G
Reference: Full Genomes Corp. (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: downstream of R1b L21 S691
Forward Primer: FGC19639_F TTCAGGGAGTATATGTATTGCCC
Reverse Primer: FGC19639_R TACAGCACGCCACACAGTC
Reviews

Customers who bought this product also purchased
A729
A729
A739
A739
FGC19638
FGC19638
FGC19636
FGC19636
FGC19643
FGC19643
FGC19635
FGC19635
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies