Top » Catalog » SNPs » FGC21219

$18.00

FGC21219
[FGC21219]

FGC21219
hg38 Position: ChrY:8373341..8373341
Ancestral: C
Derived: T
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: not listed
Comments: .
Forward Primer: FGC21219_F GTCACCTAGGTTTTCACTTAGTGGTAG
Reverse Primer: FGC21219_R GGAGATATTTTGACTCTCACCATTG
Reviews

Customers who bought this product also purchased
A19117
A19117
FGC21241
FGC21241
FGC21217
FGC21217
FGC21227
FGC21227
A19103
A19103
FGC21240
FGC21240
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies