Top » Catalog » SNPs » FGC17603

$18.00

FGC17603
[FGC17603]

FGC17603
hg38 Position: ChrY:13592135..13592135
Ancestral: T
Derived: C
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: Below L1335 > S764 > Z17612
Forward Primer: FGC17603_F CTGCATCATCCTGGTAAACAAG
Reverse Primer: FGC17603_R CATCCAGAGCACATAAACAACG
Reviews

Customers who bought this product also purchased
BY39168
BY39168
BY41059
BY41059
R1b-FGC17603 MacRae Panel
R1b-FGC17603 MacRae Panel
BY39172
BY39172
BY39171
BY39171
BY39170
BY39170
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies