Top » Catalog » SNPs » FGC17449

$19.00

FGC17449
[FGC17449]

FGC17449
hg38 Position: ChrY:2828667..2828667
Ancestral: C
Derived: G
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1f5a2a
Comments: .
Forward Primer: FGC17449_F CGGCTCATTGCAATATCTACC
Reverse Primer: FGC17449_R TTCTTGGTATTATCCTCCCAATAGTC
Reviews

Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies