Top » Catalog » SNPs » FGC3267

$18.00

FGC3267
[FGC3267]

FGC3267
hg38 Position: ChrY:22332595..22332595
Ancestral: C
Derived: A
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: R1b1a2a1a2c1f3 (not listed)
Comments: Below PF825.2
Forward Primer: FGC3267_F CCCACACTCACTCTGGTAGG
Reverse Primer: FGC3267_R ATTTTACCATTCCCTTTCTGAGG
Reviews

Customers who bought this product also purchased
L1495
L1495
FGC3246
FGC3246
FGC3268
FGC3268
FGC3243
FGC3243
FGC3263
FGC3263
FGC3242
FGC3242
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies