Top » Catalog » SNPs » L1495

$18.00

L1495
[L1495]

L1495
hg38 Position: ChrY:15484155..15484155
Ancestral: C
Derived: T
Reference: Thomas Krahn / WTY (2012)
ISOGG Haplogroup: not listed
Comments: Found in a hg B-M60 WTY participant
Forward Primer: L1495_F GGAAAGCTCTTAGCAGGAGTAGC
Reverse Primer: L1495_R GTCCATCACTGAACTCCAATTG
Reviews

Customers who bought this product also purchased
FGC3259
FGC3259
PF825.2
PF825.2
FGC3250
FGC3250
L430
L430
R1b-PF825.2 downstream
R1b-PF825.2 downstream
FGC3248
FGC3248
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x DYS460
$11.00
Haplogroup Info
Other products
Currencies