Top » Catalog » SNPs » MZ90

$18.00

MZ90
[MZ90]

MZ90
hg38 Position: ChrY:15682097..15682100
Ancestral: ins
Derived: del
Reference: Bachir (2015)
ISOGG Haplogroup: E1b1b1b1a
Comments: Equivalent to PF6794
Forward Primer: MZ90_F CACATCTCATTGTCATCCATACATAC
Reverse Primer: MZ90_R GGAAGGAAGGAAATAAATAGGACAG
Reviews

Customers who bought this product also purchased
Y183077
Y183077
MZ17
MZ17
M165
M165
M5343
M5343
MF4289
MF4289
Y109169
Y109169
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies