Top » Catalog » SNPs » A12543

$18.00

A12543
[A12543]

A12543
hg38 Position: ChrY:7785284..7785284
Ancestral: G
Derived: A
Reference: Ed Aber Leek (2016)
ISOGG Haplogroup: R1b
Comments: Aka BY21581. Below FGC11397 Rox2
Forward Primer: A12543_F GCAGCCTGTTGGTCTGTTTC
Reverse Primer: A12543_R CCTTTTGTTCCTTGCTCCAG
Reviews

Customers who bought this product also purchased
A12540
A12540
A15480
A15480
A12539
A12539
A15479
A15479
R1b Rox2 Hickey Segregation Panel
R1b Rox2 Hickey Segregation Panel
A12570
A12570
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies