Top » Catalog » SNPs » Y2245

$18.00

Y2245
[Y2245]

Y2245
hg38 Position: ChrY:7026282..7026282
Ancestral: C
Derived: T
Reference: Vladimir Gurianov (2013)
ISOGG Haplogroup: Q1b1 (not listed)
Comments: Q-Y2250 level downstream of M378
Forward Primer: Y2245_F AAATAAGTGCCCTCCCCATC
Reverse Primer: Y2245_R CGTGAGTCTCTTTGGCCTTC
Reviews

Customers who bought this product also purchased
Z2041
Z2041
Y7234
Y7234
M168
M168
Z58
Z58
S10360
S10360
M9
M9
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies