Top » Catalog » SNPs » Y6198

$18.00

Y6198
[Y6198]

Y6198
hg38 Position: ChrY:17366738..17366738
Ancestral: T
Derived: A
Reference: Yfull (2014)
ISOGG Haplogroup: E1b1b1b2a1a1a1a1e1a~
Comments: Below PF6751 > Y6200 > Y6174
Forward Primer: Y6198_F GGCAAATAGAAACAAATCAGGTAAC
Reverse Primer: Y6198_R AAAGGGTAAGTGTCAGTTTGGC
Reviews

Customers who bought this product also purchased
M96
M96
Y29430
Y29430
Z834
Z834
PF6751
PF6751
*TOP* - Top-Level Orientation Panel
*TOP* - Top-Level Orientation Panel
BY10486
BY10486
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies