Top » Catalog » SNPs » Z26015

$18.00

Z26015
[Z26015]

Z26015
hg38 Position: ChrY:6981210..6981210
Ancestral: C
Derived: G
Reference: Ray Banks (2015)
ISOGG Haplogroup: O2a2b1a1a6b1b (not listed)
Comments: under Z25610
Forward Primer: Z26015vl_F CACTAGCGGCATGTGACTG
Reverse Primer: Z26015vl_R CCTCAATGTGGACAAACACC
Reviews

Customers who bought this product also purchased
M268
M268
F114
F114
Z26010
Z26010
F145
F145
M133
M133
F14289
F14289
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies