Top » Catalog » SNPs » V1174

$18.00

V1174
[V1174]

V1174
hg38 Position: ChrY:6800596..6800596
Ancestral: C
Derived: A
Reference: Trombetta et al (2015)
ISOGG Haplogroup: E1b (not listed)
Comments: Approx. CTS194
Forward Primer: V1174_F GGCACAGGCTATAATGAGTGAG
Reverse Primer: V1174_R ATTTCATGATCGTGGCAGAG
Reviews

Customers who bought this product also purchased
M96
M96
V65
V65
M215
M215
V12
V12
HU159
HU159
CTS8432
CTS8432
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies