Top » Catalog » SNPs » Y12782

$18.00

Y12782
[Y12782]

Y12782
hg38 Position: ChrY:20351596..20351596
Ancestral: T
Derived: C
Reference: YFull (2015)
ISOGG Haplogroup: C2b1a3~ (not listed)
Comments: Below F1918
Forward Primer: Y12782_F ACAATTTTCTCCCATTCTGTAGGTAG
Reverse Primer: Y12782_R TTCCATGCTTAGCACGCC
Reviews

Customers who bought this product also purchased
F3770
F3770
ZQ31
ZQ31
F3918
F3918
BY183180
BY183180
M48
M48
Y4580
Y4580
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies