Top » Catalog » SNPs » A16005

$18.00

A16005
[A16005]

A16005
hg38 Position: ChrY:3046415..3046415
Ancestral: C
Derived: T
Reference: Nigel Bond (2017)
ISOGG Haplogroup: R1b
Comments: Downstream DF13 > Z39589 > S16264 > L679
Forward Primer: A16005_F CTCAAGCATCCTCCACTCC
Reverse Primer: A16005_R AGATGTAGAAAGTACCCCACTCATC
Reviews

Customers who bought this product also purchased
A16004
A16004
A7314
A7314
A7313
A7313
FGC59880
FGC59880
R1b-S16264 Turner Panel
R1b-S16264 Turner Panel
FGC59873
FGC59873
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies