Top » Catalog » SNPs » FGC62847

$18.00

FGC62847
[FGC62847]

FGC62847
hg38 Position: ChrY:13140200..13140200
Ancestral: A
Derived: C
Reference: Tim Duncan (2017)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: FGC62847_F CCTGACCAACATGGTGAAAC
Reverse Primer: FGC62847_R TTCTTGCTTTCTTTTGGGATTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies